Note: DeepPrime and SynDesign are also available and may be used for a larger variety of prime editing guide RNA recommendations and efficiency predictions across diverse cell lines.
The Load Example button is able to replicate the example inputs shown in this help page for quick testing of the DeepPE web server. Simply click the Load Example button then press Submit Job to obtain an example results page.
Input Format: Nine formats are accepted, and each one resolves to the target sequences this model scores: FASTA, Gene Symbol, NMID, Ensembl ID, HGNC ID, Genomic Position, Edit Sequence (an unedited/edited pair), ClinVar ID and COSMIC ID. Picking one shows the fields it needs and hides the rest.
Input Method (FASTA): You can either enter the FASTA text or upload a FASTA file.
.txt
.fa
.fasta
When uploading files, press the [+] button to add files. Uploaded files can be cleared by pressing either of the checkmark buttons.
Example Input:
>MIR99AHG/LINC00478 (chr21:16,587,284-16,587,784) CAGACAGCATTAGAGTTGGCTTGAGAATTGCCGTACTTTGCTTCCCTTTGTATGTATTTC TTGTATGCTGCCGAGTCACTGATGGCTAGCTCTGTCTGGCAAGTAATTCAAAAATGCTGT TTATGTAGAAAGGAAAGGTAGGGACTTTACCACACTCTGTCATTAAAGGGAGCAATTGAA GAACAAAGGAACTGAGTAAATACCTATATATTGCCTTTTGTGTTGCGAAACACTGTAGCA CAAACACATTTGTGTTCAGCCAAATGTTTTACTTCCTTTTGTAATAACGCATATAGTAGG TTGTCTCCACATATGTACAAGAATCCATATTTTATTTAAACGTATATAGTCAATTGTTCA TATTTATAGGCTGCAAACATTTCTCAATCTCAAAGACTTTTACATATCCACTCCCACACA GCTATTTGTTATTATTTTAAAAGTTCTTAAATTAAAAAAAAAAATAAAATATACTAATAT CTCTGTTGGTTGATTTTATTA
A gene identifier is looked up in Human (GENCODE v50 on GRCh38) or Mouse (GENCODE M39 on GRCm39). A mouse symbol from an older nomenclature resolves to the current one and the job log states the substitution — Olfr1 designs against Or1e16. Whichever of the four gene formats is chosen, Mouse replaces the identifier box with Enter Mouse Gene Name or ID, which takes a mouse symbol or a mouse Ensembl gene ID. ClinVar ID and COSMIC ID carry no species selector: both are human variant databases, and both resolve against the human reference.
Olfr1
Or1e16
A mouse gene is resolved to its coding exons and the design runs across those, so the pegRNAs are the same work the human path does.
No off-target control is offered here, and the results carry no off-target column: there is no reference genome to choose, no genome-wide search, and no mismatch-tolerance score from a substitution table. Prime editors are far less sensitive to off-target editing than nucleases are — installing an edit needs the spacer to match, the nick to be made, the extension to anneal and its template to be copied in, where a nuclease needs the spacer alone — so the sites a counted-mismatch genome search returns are not the sites a pegRNA edits. The one trained prime-editing off-target model is DeepPrime's, and it is a separate output on the DeepPrime workflow.
Cloning Vector decides whether each row carries an ordering-ready spacer oligo pair, and it is set to SpCas9 / lentiGuide-Puro (BbsI or BsmBI) by default. The pair arrives as Oligo (forward) and Oligo (reverse): the two strands that anneal into the digested vector, each presenting its own 4 nt 5' overhang — CACC on the forward strand, AAAC on the reverse — around a guide written (G/g)N19. Setting the vector to None (No Oligo Output) leaves both columns out rather than blank, and the four overhang fields — Forward 5′, Reverse 5′, Forward 3′ and Reverse 3′ — override what the vector supplies, each taking the vector's own where it is left blank.
Oligo (forward)
Oligo (reverse)
CACC
AAAC
pegRNA Form decides what the extension oligos encode. Left at pegRNA (Unmodified 3' End), each row carries one extension oligo pair, GTGC and AAAA overhangs by default and overridable through the four Extension fields beside them.
GTGC
AAAA
Setting it to epegRNA (Adds a 3' Structured Motif) appends a 3' structured motif to the extension, which protects the pegRNA 3' end from exonucleolytic degradation, and adds the motif's own extension column and oligo pair per motif. epegRNA Motif Panel, shown only while epegRNA is selected, chooses which motifs: the Recommended Panel (eHAV, tevo2.0, HAV), the Extended Panel (those three plus eSBRMV1-A, FMDVA-2 and tevopreQ1), Synthetic / LNP (eSBRMV1-A), the v5 Library Screen Panel (eHAV, tevo2.0, HAV, eSBRMV1-A, eFMDVA-2.2 and eFMDVO-4), or any single motif on its own. An epegRNA is a different construct to order from a pegRNA, which is why the motif is asked for rather than applied by default, and the panel is offered rather than ranked because no feature predicts which motif wins.
No linker is inserted between the primer binding site (PBS) and the motif. The v2 motifs offered here are used by Sakai et al. with the motif joined directly to the PBS 3' end; for tevopreQ1, Nelson et al. compared pegLIT-designed 8-nucleotide linkers against no linker and reported no significant gain. The one motif whose data shows a linker is needed, mpknot, is not offered here.
The results table displays the predicted efficiencies for various pegRNA designs, and users may select a row to view the Selected Target Details.
ID: Sequence identifier.
Location: Target location indices.
Wide Target Sequence (47bp): The 47bp context sequence.
Guide Sequence: The 20bp guide sequence (Spacer).
Edit: Description of the edit (e.g., +5, G to C).
PBS Length: Length of the Primer Binding Site.
RT Length: Length of the Reverse Transcription template.
3' Extension: The 3' extension sequence.
Prediction Score: The predicted prime editing (PE) efficiency score.
Prediction Model: The specific sub-model used (DeepPE, PE_Position, PE_type).
DeepPE
PE_Position
PE_type
You can download the full results as a ZIP file using the Download Results button.
The following example interactive outputs are available for reference:
If you have any questions, bug reports, or suggestions, please do not hesitate to contact us through the Support page.
