Using DeepSmallCas9

Using DeepSmallCas9Load Example Load_Example

The Load Example button is able to replicate the example inputs shown in this help page for quick testing of the DeepSmallCas9 web server. Simply click the Load Example button then press Submit Job to obtain an example results page.Enzymes and Off-Target Settings Input_Enzymes

First, select the small Cas9 ortholog/variant type. Multiple entries can be selected, but note that only sRGN3.1 and SlugCas9 support bulge mutation off-target screening. Input_Off

Then, for off-target activity prediction, select the organism (or the option not to perform off-target screening) and the maximum number of mutations for each type.Selecting a genome will initiate a search for all potential off-targets across the whole genome, which will significantly increase the running time (possibly hours to days).Again, note that only sRGN3.1 and SlugCas9 support bulge mutation off-target screening.InputFASTA Input Input_Text

Input Method: You can either enter the FASTA text or upload a FASTA file.

Enter FASTA Text: Enter target sequences in FASTA format. Each sequence must be long enough to hold one whole target window — 32 to 38 bp, depending on the selected ortholog — and a longer sequence is scanned for every window that fits inside it, since a window that does not fit whole is skipped.

Upload FASTA File: Upload a .txt, .fa, or .fasta file containing the target sequences.

When uploading files, press the [+] button to add files. Uploaded files can be cleared by pressing either of the checkmark buttons.Example Input:>MIR99AHG/LINC00478 (chr21:16,587,284-16,587,784) CAGACAGCATTAGAGTTGGCTTGAGAATTGCCGTACTTTGCTTCCCTTTGTATGTATTTC TTGTATGCTGCCGAGTCACTGATGGCTAGCTCTGTCTGGCAAGTAATTCAAAAATGCTGT TTATGTAGAAAGGAAAGGTAGGGACTTTACCACACTCTGTCATTAAAGGGAGCAATTGAA GAACAAAGGAACTGAGTAAATACCTATATATTGCCTTTTGTGTTGCGAAACACTGTAGCA CAAACACATTTGTGTTCAGCCAAATGTTTTACTTCCTTTTGTAATAACGCATATAGTAGG TTGTCTCCACATATGTACAAGAATCCATATTTTATTTAAACGTATATAGTCAATTGTTCA TATTTATAGGCTGCAAACATTTCTCAATCTCAAAGACTTTTACATATCCACTCCCACACA GCTATTTGTTATTATTTTAAAAGTTCTTAAATTAAAAAAAAAAATAAAATATACTAATAT CTCTGTTGGTTGATTTTATTAGene Input Input_Gene

You may also input Human or Mouse genes for guide RNA design and efficiency prediction.The list of supported gene inputs are available in Human Genes Set and Mouse Genes Set.Input FormatsNine formats are accepted, and each resolves to the target sequences this web server scores: FASTA (text or file), Gene Symbol, NMID, Ensembl ID, HGNC ID, ClinVar ID, COSMIC ID, Input Sequence (an unedited/edited pair) and Genomic Position. The Input Format dropdown selects one and shows the field it needs.SpeciesA gene identifier is looked up in Human (GENCODE v50 on GRCh38) or Mouse (GENCODE M39 on GRCm39). The selector appears with the four gene formats, and it is offered wherever the genome-wide off-target search offers Mouse, so a run that screens against the mouse genome can design in mouse as well.A mouse symbol from an older nomenclature resolves to the current one and the job log states the substitution — Olfr1 designs against Or1e16. Whichever of the four gene formats is chosen, Mouse replaces the identifier box with Enter Mouse Gene Name or ID, which takes a mouse symbol or a mouse Ensembl gene ID. ClinVar ID and COSMIC ID carry no species selector: both are human variant databases, and both resolve against the human reference.Primary and Secondary PAMsEach of these orthologs recognises two classes of PAM (Seo et al. 2023, Extended Data Fig. 2b). The primary PAM is the one it cuts best, and the candidate search takes it alone. The secondary PAMs are sequences the same nuclease also cuts, less efficiently. SaCas9, for instance, has NNGRRT as its primary PAM and reads NNGRRN across both classes; St1Cas9 has NNRGAA primary beside NNABCA, NNAGGA and NNAWAA. CjCas9 and enCjCas9 recognise a single class, NNNNRYAC, so for those two there is no second class to add.Also design guides at secondary PAMs widens the search to both classes, which yields roughly two to four times as many candidates per ortholog. Both classes are ones the models can answer for: the activity libraries these networks were trained on carry matched targets at primary, secondary and inactive PAMs alike, and the PAM bases are among the models' most important input features — the most important for fifteen of the seventeen orthologs. The genome-wide off-target search enumerates both classes whichever way this setting is left, and scores what it finds with the same trained model.A secondary-PAM site is genuinely the less active of the two, and most of the extra candidates rank low. The wider set is worth asking for where the primary PAM offers no well-placed guide — a narrow edit window, a small exon — rather than as a way to find better guides than the primary class already holds.The PAM class column marks each candidate primary or secondary, so a score can be read against its own class. That column is present when both classes are searched, and absent when the primary class alone is, where every row would carry the same value. CjCas9 and enCjCas9 rows are blank in it, having one class to belong to.Homology-Directed Repair (HDR) Donor TemplatesThere is no HDR mode switch: the input format decides. When the input format specifies an edit — an unedited/edited sequence pair, a ClinVar ID or a COSMIC ID — every candidate guide is also reported with what it needs for HDR. The other six formats identify the target without specifying an edit, so no donor is designed from them and the donor columns are absent rather than blank.Cut site (1-based in the target sequence) is the blunt cut three bases from the PAM. Where that falls inside the protospacer follows the ortholog's own spacer length, and none of these seventeen uses a 20mer: between positions 16 and 17 for St1Cas9 (19 nt); between 18 and 19 for the twelve orthologs with a 21 nt spacer (the SaCas9, SauriCas9 and SlugCas9 families, sRGN3.1 and Sa-SlugCas9); between 19 and 20 for CjCas9 and enCjCas9 (22 nt); and between 20 and 21 for Nm1Cas9 and Nm2Cas9 (23 nt).Each candidate carries these columns, in the results table and in the downloadable files alike:

Cut-to-edit distance (nt) — how far the break sits from the base being changed. Candidates are ranked by it (HDR donor rank in the target), because repair efficiency falls away with distance; candidates at the same distance keep the order the model listed them in.

Donor (sense) / Donor (antisense) — the single-stranded donor carrying the edit, in the orientation(s) you asked for, ready to order.

Donor length (nt), Left arm (nt), Right arm (nt), Requested arms (nt) — arms are measured outward from the union of the cut site and the edit, not from either alone, so that a guide cutting some distance away still spans both. The realised arms therefore differ from the requested pair whenever the cut sits outside the edit, and both are reported.

Indel length not a multiple of 3 — a length test on the edit itself. It is deliberately not called frame-disrupting: the donor is built from a sequence window, so whether the position is coding at all is not knowable here.

Blocking mutation — off by default. When enabled, a change that stops the nuclease re-cutting the repaired allele.

Donor note — what shaped this donor: why a blocking mutation was or was not made, and by how much the arms were extended outward past the requested lengths so that the donor spans the cut as well as the edit. Where a row carries no donor, the note gives the reason in its place — arms that do not fit inside the supplied window, naming the extra sequence or the shorter arm that would make them fit, or a window that could not be tied to exactly one input record.

What you can set: homology arm lengths (100/100 nt by default, 50/50, or a custom pair between 25 and 1000 nt), the donor strand, whether to add a blocking mutation, and the donor template type — a chemically synthesized single-stranded oligodeoxynucleotide (ssODN) by default, with the donor note saying when a template outgrows standard oligo synthesis and should be ordered as a long single-stranded DNA (ssDNA) fragment instead; long ssDNA for those longer templates; or a double-stranded DNA (dsDNA) duplex, which arrives as one Duplex donor (dsDNA) column instead of the strand pair. The guide sequence is deliberately not yours to specify — the guides are this model's own ranked candidates, and a donor is built for each of them.Guide Cloning OligosCloning Vector decides whether the results carry an ordering-ready oligo pair, and it is set to Small Cas9 / Lenti-gRNA-Puro #84752 (BsmBI-v2) by default. Every candidate then gains Oligo (forward), Oligo (reverse) and an Oligo note, in the results table and in the downloadable files alike.That vector is scaffold-less, and the scaffold arrives in a separate BsmBI ligation whose 4 nt overhang belongs to the ortholog's own scaffold family — GTTT for the Staphylococcus family and for CjCas9/enCjCas9, GTCT for St1Cas9, GTTG for the Neisseria pair Nm1Cas9/Nm2Cas9. The reverse oligo therefore carries the complement of the overhang its own row needs rather than one fixed sequence, and Oligo note says which, per row.The guide is written in the (G/g)Nk format Seo et al. use: the initiating base is prepended rather than substituted, so it is an extra nucleotide ahead of the protospacer and matches the genome only where the base 5' of the protospacer happens to be that one. A few orthologs are transcribed from a base other than G, which the note also states.Setting the vector to None (No Oligo Output) leaves the columns out rather than blank. The four overhang fields — Forward 5′, Reverse 5′, Forward 3′ and Reverse 3′ — override what the vector supplies; left blank, each takes the vector's own, which for the reverse 5' overhang is the row's own scaffold complement. A guide carrying anything outside A, C, G and T gives an empty pair.Off-Target ScoreWith Genome-wide off-target search set to None, off-target activity comes from this model's own trained predictor, which is the same one the paper ships and needs no genome.Set it to Human or Mouse and the run instead searches the genome for real sites, and the same published per-ortholog network scores each of them — one model over two candidate sets, searched hits and synthetic variants alike. The searched hits are then aggregated per guide into the Sum of Off-target Activity and its Sum of Off-target Activity Rank, where higher is less specific, and guides whose hits fall in coding sequence get an Off-targets in CDSs accounting.No substitution matrix borrowed from another nuclease is involved. The matrices this site uses elsewhere are fitted on SpCas9 and on Cas12a, while these seventeen orthologs carry 19 to 23 nt spacers and their own PAMs, so a borrowed matrix would report one nuclease's mismatch tolerance under another's name. The published per-ortholog network answers for its own ortholog instead.Results Result_Summary

On-target outputs and summaries of off-target results are available as a summary table as well as the Selected Result Details visualization when clicking each row. The red highlight is the PAM sequence. Result_Offtarget

When clicking each cell in the ID column, an overlay showing the detailed information of off-target results for each on-target result is displayed. Download_Results

You can download the full results as a ZIP file using the Download Results button.Sample OutputsThe following example interactive outputs are available for reference:FASTA sequenceGene symbolGene symbol, mouseClinVar variantGenomic coordinatesGenome-wide off-target search, humanData and LicensingCOSMIC. COSMIC is a product of Genome Research Limited (Wellcome Sanger Institute). It is free for academic and non-commercial use; commercial use requires a COSMIC licence. Lookups here resolve a single user-typed identifier — no COSMIC data is listed, browsable or served in bulk.ContactIf you have any questions, bug reports, or suggestions, please do not hesitate to contact us through the Support page.

DeepSmallCas9 web server

All web servers

Your browser does not support ES modules.
Please use a modern browser.