Using DeepSniper

Using DeepSniper Model_Overview

Load Example

The Load Example button is able to replicate the example inputs shown in this help page for quick testing of the DeepSniper web server. Simply click the Load Example button then press Submit Job to obtain an example results page.PAM Selection Input_PAM

You are able to select a variety of PAM (Protospacer Adjacent Motif) sequences from your input sequence. DeepSniper detects PAM sequences within your input and designs guide RNAs based on them.Input Input_Text

Input Method: You can either enter the FASTA text or upload a FASTA file.

Enter FASTA Text: Enter target sequences in FASTA format. The sequence length must be >= 30 bp.

Upload FASTA File: Upload a .txt, .fa, or .fasta file containing the target sequences.

When uploading files, press the [+] button to add files. Uploaded files can be cleared by pressing either of the checkmark buttons.Example Input:>MIR99AHG/LINC00478 (chr21:16,587,284-16,587,784) CAGACAGCATTAGAGTTGGCTTGAGAATTGCCGTACTTTGCTTCCCTTTGTATGTATTTC TTGTATGCTGCCGAGTCACTGATGGCTAGCTCTGTCTGGCAAGTAATTCAAAAATGCTGT TTATGTAGAAAGGAAAGGTAGGGACTTTACCACACTCTGTCATTAAAGGGAGCAATTGAA GAACAAAGGAACTGAGTAAATACCTATATATTGCCTTTTGTGTTGCGAAACACTGTAGCA CAAACACATTTGTGTTCAGCCAAATGTTTTACTTCCTTTTGTAATAACGCATATAGTAGG TTGTCTCCACATATGTACAAGAATCCATATTTTATTTAAACGTATATAGTCAATTGTTCA TATTTATAGGCTGCAAACATTTCTCAATCTCAAAGACTTTTACATATCCACTCCCACACA GCTATTTGTTATTATTTTAAAAGTTCTTAAATTAAAAAAAAAAATAAAATATACTAATAT CTCTGTTGGTTGATTTTATTAInput FormatsNine formats are accepted, and each resolves to the target sequences this web server scores: FASTA (text or file), Gene Symbol, NMID, Ensembl ID, HGNC ID, ClinVar ID, COSMIC ID, Input Sequence (an unedited/edited pair) and Genomic Position. The Input Format dropdown selects one and shows the field it needs.SpeciesA gene identifier is looked up in Human (GENCODE v50 on GRCh38) or Mouse (GENCODE M39 on GRCm39). The selector appears with the four gene formats, and it is offered wherever the genome-wide off-target search offers Mouse, so a run that screens against the mouse genome can design in mouse as well.A mouse symbol from an older nomenclature resolves to the current one and the job log states the substitution — Olfr1 designs against Or1e16. Whichever of the four gene formats is chosen, Mouse replaces the identifier box with Enter Mouse Gene Name or ID, which takes a mouse symbol or a mouse Ensembl gene ID. ClinVar ID and COSMIC ID carry no species selector: both are human variant databases, and both resolve against the human reference.Homology-Directed Repair (HDR) Donor TemplatesThere is no HDR mode switch: the input format decides. When the input format specifies an edit — an unedited/edited sequence pair, a ClinVar ID or a COSMIC ID — every candidate guide is also reported with what it needs for HDR. The other six formats identify the target without specifying an edit, so no donor is designed from them and the donor columns are absent rather than blank.Cut site (1-based in the target sequence) is the blunt SpCas9-family cut, between protospacer positions 17 and 18 — three bases from the PAM.Each candidate carries these columns, in the results table and in the downloadable files alike:

Cut-to-edit distance (nt) — how far the break sits from the base being changed. Candidates are ranked by it (HDR donor rank in the target), because repair efficiency falls away with distance; candidates at the same distance keep the order the model listed them in.

Donor (sense) / Donor (antisense) — the single-stranded donor carrying the edit, in the orientation(s) you asked for, ready to order.

Donor length (nt), Left arm (nt), Right arm (nt), Requested arms (nt) — arms are measured outward from the union of the cut site and the edit, not from either alone, so that a guide cutting some distance away still spans both. The realised arms therefore differ from the requested pair whenever the cut sits outside the edit, and both are reported.

Indel length not a multiple of 3 — a length test on the edit itself. It is deliberately not called frame-disrupting: the donor is built from a sequence window, so whether the position is coding at all is not knowable here.

Blocking mutation — off by default. When enabled, a change that stops the nuclease re-cutting the repaired allele.

Donor note — what shaped this donor: why a blocking mutation was or was not made, and by how much the arms were extended outward past the requested lengths so that the donor spans the cut as well as the edit. Where a row carries no donor, the note gives the reason in its place — arms that do not fit inside the supplied window, naming the extra sequence or the shorter arm that would make them fit, or a window that could not be tied to exactly one input record.

What you can set: homology arm lengths (100/100 nt by default, 50/50, or a custom pair between 25 and 1000 nt), the donor strand, whether to add a blocking mutation, and the donor template type — a chemically synthesized single-stranded oligodeoxynucleotide (ssODN) by default, with the donor note saying when a template outgrows standard oligo synthesis and should be ordered as a long single-stranded DNA (ssDNA) fragment instead; long ssDNA for those longer templates; or a double-stranded DNA (dsDNA) duplex, which arrives as one Duplex donor (dsDNA) column instead of the strand pair. The guide sequence is deliberately not yours to specify — the guides are this model's own ranked candidates, and a donor is built for each of them.Guide Cloning OligosCloning Vector decides whether the results carry an ordering-ready oligo pair, and it is set to SpCas9 / lentiGuide-Puro (BbsI or BsmBI) by default. Every candidate then gains Oligo (forward) and Oligo (reverse), in the results table and in the downloadable files alike: the two strands that anneal into the digested vector, each presenting its own 4 nt 5' overhang — CACC on the forward strand, AAAC on the reverse. The guide between them is written (G/g)N19, position 1 replaced by the G the U6 promoter transcribes from.Setting the vector to None (No Oligo Output) leaves both columns out rather than blank. The four overhang fields — Forward 5′, Reverse 5′, Forward 3′ and Reverse 3′ — override what the vector supplies; left blank, each takes the vector's own. A guide carrying anything outside A, C, G and T gives an empty pair, because there is nothing orderable to write.Genome-wide Off-Target SearchBy default no genome is searched: the off-target overlay attached to each on-target result is computed by this model's own trained networks, not by a search. Setting Genome-wide off-target search to Human or Mouse searches the reference genome for every site within the chosen mismatch budget, and each site it returns is scored by the published Sniper off-target networks — the same job other models hand to a substitution table, done here by the model trained for it. Per guide, the sums over those sites appear as Sum of Off-target Activity (Sniper1.0) and Sum of Off-target Activity (Sniper2.0L) alongside their ranks. A whole-genome search can take hours to days, so it is off by default. Sniper_Search

The four columns the search adds: per guide, the sums this model's off-target networks give to the sites the search returned, and each guide's rank among all guides by that sum. Guides with nothing found within the mismatch budget carry a sum of 0.Results Sniper_Results

On-target outputs are available as a summary table as well as the Selected Target Details visualization when clicking each row. The red highlight is the PAM sequence. Sniper_Offtarget

When clicking the ID column, an overlay showing the off-target results for each on-target result is displayed.Prediction scores are divided into (G/g)N19 (using the U6 promoter, which requires a guanosine (G) as the first nucleotide to initiate transcription efficiently) and tRNA-N20 (using the endogenous tRNA-processing system) scores. Download_Results

You can download the full results as a ZIP file using the Download Results button.Sample OutputsThe following example interactive outputs are available for reference:FASTA sequenceGene symbolClinVar variantSequence pairGenomic coordinatesGenome-wide off-target search, humanData and LicensingCOSMIC. COSMIC is a product of Genome Research Limited (Wellcome Sanger Institute). It is free for academic and non-commercial use; commercial use requires a COSMIC licence. Lookups here resolve a single user-typed identifier — no COSMIC data is listed, browsable or served in bulk.ContactIf you have any questions, bug reports, or suggestions, please do not hesitate to contact us through the Support page.

DeepSniper web server

All web servers

Your browser does not support ES modules.
Please use a modern browser.