The Load Example button is able to replicate the example inputs shown in this help page for quick testing of the DeepTrunc-cell web server. Simply click the Load Example button then press Submit Job to obtain an example results page.
A total of five models may be selected, where the available spacer length ranges are within parentheses of each model.
DeepTrunc-HF1-cell (SpCas9-HF1) and DeepTrunc-SP-cell (SpCas9) are base models (trained only from their own data), and are likely to be the most robust options for arbitrary guide RNA design.
DeepTrunc-FnCas9-cell (FnCas9), DeepTrunc-FnCas9-en1-cell (FnCas9-en1), and DeepTrunc-FnCas9-en31-cell (FnCas9-en31) are fine-tuned models based on the DeepTrunc-HF1-cell base model to predict activities for FnCas9 variants.
Inputs must be in comma-separated format without indexes or headers, in the order of 'Target','sgRNA'.
'Target','sgRNA'
Example 35 bp Target: TCGAGATCGTAGCAAGCTAGCTAGCGGTTGACCTA (Full Target Sequence) = TCGA (5' Upstream Flank, variable-length) + GATCGTAGCAAGCTAGCTAG (Protospacer, variable-length) + CGG (PAM Sequence, 3 bp) + TTGACCTA (3' Downstream Flank, 8 bp)
TCGAGATCGTAGCAAGCTAGCTAGCGGTTGACCTA
TCGA
GATCGTAGCAAGCTAGCTAG
CGG
TTGACCTA
The Target sequence must be 35 bp total, where the length of the 5' Upstream Flank and Protospacers are based on the sgRNA's spacer length.
Example sgRNA: GATCGTAGCTAGCTAGCTAG (variable-length, starting with G)
GATCGTAGCTAGCTAGCTAG
The spacer length of target sequences and sgRNA can range from GN16 to GN21 (variable depending on the CRISPR–Cas variant).
Type of Model selects which nuclease variant scores the pair: DeepTrunc-HF1-cell, DeepTrunc-SP-cell, DeepTrunc-FnCas9-cell, DeepTrunc-FnCas9-en1-cell or DeepTrunc-FnCas9-en31-cell. All of them take GN16–GN21 spacers except DeepTrunc-SP-cell, which takes GN16–GN19.
Use df[['Target', 'sgRNA']].to_csv('input.txt', sep=',', index=None, header=None) when using Pandas to produce the input.
df[['Target', 'sgRNA']].to_csv('input.txt', sep=',', index=None, header=None)
Example input:
TCGAGATCGTAGCAAGCTAGCTAGCGGTTGACCTA,GATCGTAGCTAGCTAGCTAG
The results page produces the predicted indel ratio index of matched/mismatched target–sgRNA pairs across different spacer lengths.
You can download the full results as a CSV file using the Download button at the top-right.
The following example interactive outputs are available for reference:
If you have any questions, bug reports, or suggestions, please do not hesitate to contact us through the Support page.
