Note: DeepPrime and SynDesign are available for deep-learning based automated prime editor guide RNA design and efficiency prediction across diverse cell lines.
The Load Example button is able to replicate the example inputs shown in this help page for quick testing of the PEselector web server. Simply click the Load Example button then press Submit Job to obtain an example results page.
Enter comma-separated sequences for Target, Reverse transcription template (RTT), and Primer binding site (PBS).
The input here is a pegRNA that has already been designed — a Target, RTT and PBS triple, read position by position — rather than a locus to design one from, so none of the nine input formats the sibling prime-editing workflows offer appears on this form. It is what the input is, not something missing from it.
Ensure the number of entries in each field matches perfectly (1st Target pairs with 1st RTT and 1st PBS, etc.).
The job will fail if the number of comma-separated sequences in each of the three fields do not match.
Target Sequences: exactly 47bp (e.g., AGGATATGTGCCGTAAGTACGGTGAGGTGGAAGAGGTAGAGATCCTC) — 4bp of upstream context, the 20bp protospacer, the 3bp PAM and 20bp downstream.
RTT Sequences: 1 to 24 nt (e.g., CCTCTTCCACCTCA)
PBS Sequences: 1 to 17 nt (e.g., CGTACTTACGGCA)
The model carries one feature slot per position, so a triplet outside those lengths is not scored: it is dropped from the results, and the job log names the entry and gives the length it had. A triplet holding a character other than A, C, G or T is dropped the same way. Every other entry is scored and returned, so a results table shorter than the input is worth reading the log for.
Primer Binding Site (PBS): The PBS domain binds to the nicked DNA strand to initiate reverse transcription.
Reverse Transcription Template (RTT): The RTT domain contains the desired genetic edit to be integrated into the genome.
No off-target control is offered here, and the results carry no off-target column: there is no reference genome to choose, no genome-wide search, and no mismatch-tolerance score from a substitution table. Prime editors are far less sensitive to off-target editing than nucleases are — installing an edit needs the spacer to match, the nick to be made, the extension to anneal and its template to be copied in, where a nuclease needs the spacer alone — so the sites a counted-mismatch genome search returns are not the sites a pegRNA edits. The one trained prime-editing off-target model is DeepPrime's, and it is a separate output on the DeepPrime workflow.
Cloning Vector decides whether each row carries an ordering-ready spacer oligo pair, and it is set to SpCas9 / lentiGuide-Puro (BbsI or BsmBI) by default. The pair arrives as Oligo (forward) and Oligo (reverse): the two strands that anneal into the digested vector, each presenting its own 4 nt 5' overhang — CACC on the forward strand, AAAC on the reverse — around a guide written (G/g)N19. Setting the vector to None (No Oligo Output) leaves both columns out rather than blank, and the four overhang fields — Forward 5′, Reverse 5′, Forward 3′ and Reverse 3′ — override what the vector supplies, each taking the vector's own where it is left blank.
Oligo (forward)
Oligo (reverse)
CACC
AAAC
pegRNA Form decides what the extension oligos encode. Left at pegRNA (Unmodified 3' End), each row carries one extension oligo pair, GTGC and AAAA overhangs by default and overridable through the four Extension fields beside them.
GTGC
AAAA
Setting it to epegRNA (Adds a 3' Structured Motif) appends a 3' structured motif to the extension, which protects the pegRNA 3' end from exonucleolytic degradation, and adds the motif's own extension column and oligo pair per motif. epegRNA Motif Panel, shown only while epegRNA is selected, chooses which motifs: the Recommended Panel (eHAV, tevo2.0, HAV), the Extended Panel (those three plus eSBRMV1-A, FMDVA-2 and tevopreQ1), Synthetic / LNP (eSBRMV1-A), the v5 Library Screen Panel (eHAV, tevo2.0, HAV, eSBRMV1-A, eFMDVA-2.2 and eFMDVO-4), or any single motif on its own. An epegRNA is a different construct to order from a pegRNA, which is why the motif is asked for rather than applied by default, and the panel is offered rather than ranked because no feature predicts which motif wins.
No linker is inserted between the primer binding site (PBS) and the motif. The v2 motifs offered here are used by Sakai et al. with the motif joined directly to the PBS 3' end; for tevopreQ1, Nelson et al. compared pegLIT-designed 8-nucleotide linkers against no linker and reported no significant gain. The one motif whose data shows a linker is needed, mpknot, is not offered here.
The results table shows the prediction scores for each triplet.
Regression Score: Predicted regression efficiency of Support Vector Machine (SVM).
Classification: Binary classification result from the SVM classifier, indicating whether the pegRNA is predicted to be efficient. This is a separate trained model from the Regression Score, so the two can disagree near the decision boundary.
DeepSpCas9 Score: Cas9 cleavage efficiency score, based on the DeepSpCas9 deep-learning model.
Beside those three, each row carries the ordering columns the Oligo Output settings produce: Oligo (forward) and Oligo (reverse) for the spacer, and the extension oligo pair — one pair for a plain pegRNA, or one motif column and one oligo pair per motif for an epegRNA, with a Pol III terminator in the epegRNA extension column reading Yes where any of those extensions carries a run of four or more T's, which terminates pol III transcription. They are in the downloadable files as well as the grid.
Pol III terminator in the epegRNA extension
Yes
If you have multiple inputs, you may click on each row to update the Selected Entry Details visualization.
The Download Results button hands you PEselector_Results.zip, which holds the full table as PEselector_Results.txt. The derived columns are written onto that table before the archive is built, so the file you open carries them.
PEselector_Results.zip
PEselector_Results.txt
The following example interactive outputs are available for reference:
epegRNA. The engineered pegRNA (epegRNA) 3' motifs (tevopreQ1, tevo2.0 and the related v2 motifs) are the subject of a Broad Institute patent application; commercial users may need a licence to use them.
If you have any questions, bug reports, or suggestions, please do not hesitate to contact us through the Support page.
